Ever notice how irritating it is to see two sequences that are supposed to look aligned, and they don't?  Wonder how those computer programs and books always show sequences aligned just perfectly with one another or with number below them?

Want to learn how to do that?  Or, would you prefer to earn scorn and lose points?

The key is FONT.

ALWAYS use non-proportional fonts when you represent DNA or protein sequences or alignments.  

What are proportional and non-proportional fonts?  Proportional fonts use different amounts of space for different characters.  They are MUCH more readable and much denser.  Almost all books and papers are written with these fonts.  For example, a G may actually be wider than a T.  In alignments, a . (dot) is alot narrower than a - (dash), for example.  NON-proportional fonts are fonts in which each character is assigned the same width.  These are sometimes called typewriter fonts.  Examples will clarify.

GATCGATCGATCGATCGATC    in default, basically Times Roman
GATCGATCGATCGATCGATC    in Courier New, a NON-proportional font

Now, let's compare FIVE DIFFERENT sequences of the same length in both fonts.

Some examples of the two font types are:

BIO520