BIO520 Final Exam part 2 Spring 2009

Please email this lab to Jim Lund (jiml@uky.edu) with a subject line "BIO520 Final Exam part 2" and name the document like so: "LundJ_final" or hand in written answers. Fill in your name on the exam!

You may use any books, notes, web pages, software programs, or related materials to complete this exam. You MAY NOT consult with any person regarding the exams intellectual content.

Exam links

NCBI website
BLAST results (question 2)
PHYLIP programs at The Institut Pasteur, Paris
Phobius (question 9)
Phobius output for CFTR (question 9).

1. This question concerns the human CFTR gene (cystic fibrosis transmembrane conductance regulator).
a. (2 pts) Give the accession numbers for the RefSeq protein and nucleotide entries for this gene.
b. (1 pt) Give the chromosomal location of this gene.
c. (1 pt) Which genes are adjacent to CFTR on the chromosome?
d. (2 pt) What human phenotype or genetic disease is associated with mutations or variants in this gene? Give your source for this information.
e. (1 pt) The structure for a part of the CFTR protein has been experimentally determined, but no structure has been made for the complete protein. Is this surprising or to be expected and why?

2. This question concerns the results of BLAST search using human PAX4 linked at the top of the page.
a. (2 pts) Describe and give the appropriate database IDs for two of the protein domains in the human PAX4 gene.
b. (2 pts) What BLAST program was used and what database was searched?
c. (2 pts) Do these results include every sequence matching the human PAX4 in the database? Support your answer.
d. (2 pts) Examine the match to sequence NP_001071090.1 from the flour beetle Tribolium castaneum. What is the E-value for this match and does this E-value indicate a significant or a spurious match?

3. Alpha-amylase is the salivary enzyme that breaks down starch. Examine structure of alpha-amylase with PDB ID 1SMD.
3a (2 pts). What method was used to determine this structure, and what is its resolution?
3b (2 pts). Give a rough estimate of the size of the protein along its long axis. Include units in your anaswer.

4. (2 pts) Examine the dotplot of pairing for RNA sequence 'ggagccctgtcaccggatgtgctttccggtctgatgagtccgtgaggacaaaacagggctcccgaatt' shown here RNA dotplot. Base pair 1 is at the top left, bp 68 is at the bottom right. On the provided piece of paper 1) write your name and 2) draw this RNA structure.

5. Use a parsimony tree building method to generate a consensus phylogenetic tree from the given CLUSTAL aligned engrailed protein sequences: engrailed.fasta.
5a (2 pts). Which sequence would you use as an outgroup and why?
5b (2 pts). Paste/draw the consensus tree generated by PHYLIP Protpars.
5c (2 pts). Indicate a strongly supported clade in the consensus tree and describe the evidence you have for this clade.

6. Refer to the M vs. A graph of yeast spotted microarray data for this question: M_vs_A plot.
6a (2 pts). Has this microarray been normalized? Explain the basis for your conclusion.
6b (2 pts). Give a brief explanation of what 'M' and 'A' represent in the figure.

7. Ninety-seven yeast genes were clustered using hierarchical clustering by genes with Pearson correlation (center) as the similarity measure. The resulting clustergram is shown here: cluster.png, the data files for this cluster are here: cdt, gtr.
7a (2 pts). The genes GLG1 and DAL80 are in adjacent rows and the dendrogram in the left panel shows that they are tightly clustered. Do all genes in adjacent rows in a hierarchical cluster have an expression pattern similar to their neighbor and show tight clustering?
7b (1 pts). What do the gray squares indicate?
7c (2 pts). Will these two genes cluster together if a different similarity measure or clustering algorithm is used? Indicate why this would be the case or describe a situation in which they wouldn't cluster tightly together.

8. Examine the interactions for the human SIRT1 protein that are cataloged in the IntAct database: SIRT1 interactions.
8a (2 pts). Describe the interaction between SIRT1 and Per2, a circadian rhythm gene. What type of experiment demonstrated the interaction, and is it a direct or indirect interaction?
8b (2 pts). Which of the genes SIRT1 interacts with is found in the nucleus?
8b (2 pts). Which of the interactions human SIRT1 is involved in have also been demonstrated in experiments with mouse Sirt1?

9. Examine the Phobius transmembrane segment predictions for CFTR: Phobius output for CFTR.
9a (1 pts). How many transmembrane segments is CFTR predicted to have?
9b (2 pts). Give the predicted location for the N- and C- ends of the protein, intercellular or extracellular.

10. (2 pts). In WGS sequencing, after subcloning often both ends of each clone are sequenced. What is the advantage to sequencing both ends rather than just a single end?

BIO520

Site maintained by Jim Lund